Name:_________________________

Date: ____________ Period: _____

 

 

"Break the Code" Worksheet

 

 

The following code represents a portion on a strand of DNA. This code, when correctly broken, will translate into a message that makes sense. If a portion of the original code is missing or incorrectly interpreted, the message may become nonsense.

 

Use the alphabet translation key at the bottom of this page to crack the DNA coded message. Remember that in the cell the  ribosome will “read”  sets of three nucleotides at a time (codons) during the translation of the genetic material into a protein.

 

THE CODED MESSAGE:

 

GGUGCUCGGUGUCAGGCUCAGCGGCCUCAUAAUUGUGGGCAGAUGGCU

UUAUGUCAGGCUCAGAAUGGUCCUCAUAAUUGUGGGCAGAGAUGUCAG

GAUUGGGCGCAACAGGMUGGUGUUGUCC

 

1    Translate this code using the “TRANSLATION KEY” below.

 

 

 

2.   Add a mutation to the code “mutation”. 

 

 

 

3.   What type of mutation did you put into your DNA strand?

 

    TRANSLATION KEY:

 

            a = GCU   b = AGA   c = AAU   d = GAU   e = UGU   f = GAA

     g = CAA   h = GGU   i = CAU   j = AUU   k = UUA  l = AAA

     m = AUG   n = UUU  o = CCU   p = UCU   q = ACU   r = UGG

     s = UAU   t = GUU   u = GCG   v = CGG   w = AAC   x = GAC

     y = UGC   z = GAG

 

space = CAG               comma = GGG             exclamation = CCC

 

 


 

4. Now that you know the basics, break this code:

GAUUUUGCUCAGCAUUAUCAGAACGGUUGUUGGUGUCAGGUUGUUUGU

CAGCAAUGUUUUUGUUAUCAGGCUUGGUMCCC

 

 

 

 

 

5.   Where is the mutation?        (a) start;  (b) middle;  (c) end

 

6.   If you correct the mutation, how would the message read?

 

7.   Write your own coded message of 6 or more words and give the decoding (what the actual words are).

 

 

 

 

 

 

8.   Write your coded message again with a mutation in it. Circle the mutated code.

 

 

 

 

 

9.   If your code represented a section ofa chromosome making 6 or more genes (words), show the code below for the code that would be required on the mRNA to make the corresponding proteins in the cytoplasm at the ribosomes.